Iconocast Logo

Welcome To Iconocast

How to add a URL link from your web site to the Iconocast web sites

Virtual tour of Southern California

blank

 

Recent News and Articles on the Keywords: a primer + camp primer + camp  Related to the article below (Last Update: 7/1/2008)


Wall Street Journal Blogs
Disney?s ?Camp Rock? Onslaught: A Buzzwatch Primer
Wall Street Journal Blogs, NY - Jun 20, 2008
For tonight is the television premiere of the Disney Channel?s latest live-action musical extravaganza, ?Camp Rock,? starring, omigod, the Jonas Brothers ...
Girls learn about construction
San Diego Union Tribune, United States - Jun 28, 2008
Formally called MAGIC Camp, which stands for Mentoring a Girl in Construction, the program offers specialized training for would-be engineers and builders. ...
The Procrastinator's July 4 camping guide
Rocky Mountain News, CO -
... of the camp sites in state park campgrounds are taken, but first-come, first-served sites are still available in some federal areas. Here's a primer on ...
Camp They-Be-Gone
Washington Post, United States - Jun 25, 2008
Although some aspects of woodsy life never change (archery and musty bunks), a survival guide for Summer Camp 2008 must include a primer about ...
Training camp primer
The Province, Canada - Jun 5, 2008
Training camp: McMahon Stadium in Calgary. Pre-season games: June 13 vs. Edmonton; June 19 at BC Off-field moves: Hired coach and general manager John ...
Youths get primer on emergency response
Battle Creek Enquirer, MI - Jun 20, 2008
Situations such as this were common in Albion on Thursday as children ages 8 to 12 attended Camp 911 where they learned about various first-aid techniques, ...

Boston Globe
Head for the Hills
Boston Globe, United States - Jun 28, 2008
Herein, our summer primer on the Blue Hills Reservation. As I take the first few steps of a run on the quiet Ponkapoag Trail in Blue Hills Reservation one ...

Family Security Matters
Exclusive: The Patriot Game
Family Security Matters, NJ -
Most of the Federalists ended up in this camp if only because they saw a need to restrain the passions of the common man and keep a strong hand on the ...

CNET News
Getting trained at Space Camp
CNET News, CA - Jun 17, 2008
During their week here, kids aged 7 to 18 get a primer in a series of space-related activities, including piloting a space shuttle, running a shuttle ...
WSOP Academy to Host Main Event Primer
Pokerpages.com - Jun 20, 2008
... most advanced curriculum on No-Limit Hold'em tournament strategy at its upcoming Main Event Primer, a comprehensive, three-day poker camp and experience ...
Source: Google News

… and sequencing of variable regions in bacterial 23S ribosomal RNA genes with conserved primer -
G Van Camp, S Chapelle, R De Wachter - Current Microbiology, 1993 - Springer
... Bacterial 23S Ribosomal RNA Genes with Conserved Primer Sequences Guy Van
Camp] Sabine Chapelle, and Rupert De Wachter Department ...

Discrimination among thermophilic Campylobacter species by polymerase chain reaction amplification … -
M Eyers, S Chapelle, G Van Camp, H Goossens, R De … - Journal of Clinical Microbiology, 1993 - pubmedcentral.nih.gov
... Van Camp G, Chapelle S, De Wachter R. Amplification and sequencing of variable regions
in bacterial 23S ribosomal RNA genes with conserved primer sequences. ...

[CITATION] Evidence that the clonogenic cell in multiple myeloma originates from a pre-switched but somatically … -
MHC Bakkus, IV Riet, BV Camp, K Thielemans - British Journal of Haematology, 1994 - Blackwell Synergy
... 1979: Van Camp et al, 1981: Bast et al, 1982; Caligaris-Cappio et al, ... were performed
on oligo d(T) primed first-strand cDNA using different primer combinations ...

[CITATION] Determination of the Carrier Frequency of the Common GJB2 (Connexin-26) 35delG Mutation in the … -
K Storm, S Willocx, K Flothmann, G Van Camp - HUMAN MUTATION, 1999
... Correspondence to: Guy Van Camp, Department of Medical ... RESULTS Using the principle
of PSDM, we developed a primer set with a modified reverse primer for am ...

Nonsyndromic hearing impairment is associated with a mutation in DFNA5 -
… , PJ Willems, PK Legan, GP Richardson, G Van Camp - Nature Genetics, 1998 - nature.com
... Correspondence should be addressed to Guy Van Camp gvcamp@uia.ua.ac.be. ... complex mutation
at the mRNA level, RT-PCR was done using a forward primer from exon 7 ...

An Analysis of Linkage Disequilibrium in the Interleukin-1 Gene Cluster, Using a Novel Grouping … -
A Cox, NJ Camp, MJH Nicklin, FS di Giovine, GW … - The American Journal of Human Genetics, 1998 - Elsevier
... Author Contact Information , a , E-mail The Corresponding Author , Nicola J. Camp * ,
a , Martin ... 9.0, 1.5 mM MgCl 2 , 200 ?M dNTPs, 25 ng each primer, 50 ng ...

An Interleukin-1 Genotype Is Associated with Fatal Outcome of Meningococcal Disease -
RC Read, NJ Camp, FS di Giovine, R Borrow, EB … - The Journal of Infectious Diseases, 2000 - UChicago Press
... 3'. Reverse primer, 5'-CAA AAG AAA TGG AGG CAA TAG GTT-3'. Cycling ... 11.
Cox A, Camp NJ, Nicklin MJH, di Giovine FS, Duff GW. An ...

… cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer -
MA Frohman, MK Dush, GR Martin? - Proc Natl Acad Sci US A, 1988 - pubmedcentral.nih.gov
... Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. ...
cells: generation of parietal endoderm by retinoic acid and dibutyryl cAMP. ...

… of streptococci isolated from various sources by determination of cfb gene and other CAMP-factor … -
AA Hassan, A Abdulmawjood, AO Yildirim, K Fink, C … - Can. J. Microbiol, 2000 - article.pubs.nrc-cnrc.gc.ca
... U34322) and the primer design program OLIGO 4.0 with the temperature program
mentioned above. The oligonucleotide primer camp-ub-I had the se- ...

?-Catenin Dysregulation in Thyroid Neoplasms Down-Regulation, Aberrant Nuclear Expression, and … -
G Garcia-Rostan, RL Camp, A Herrero, ML Carcangiu, … - American Journal of Pathology, 2001 - ASIP
... Ginesa Garcia-Rostan * , Robert L. Camp * , Agustin Herrero , Maria Luisa Carcangiu ...
of the ?-catenin gene (forward: 5'-primer GCTGATTTGATGGAGTTGGAA; reverse: 3 ...

Source: Google Scholar
 
 

A primer on how to camp

 

 

Go ahead, say it out loud: You've never been camping before.

Never pitched a tent in Northwest drizzle or fallen asleep listening to the wind in the firs. Never — gasp! — eaten a s'more.

If you'd like to try camping but don't know where to start, this one's for you: a primer to get you outfitted for a weekend of car camping. Don't blame us if the experience turns you into a Gore-Tex-clad, bivouacking backcountry warrior by summer's end.

A weekend of car camping could run less than $200 for basic, no-frills gear or could top $1,500 for high-end, name-brand equipment.

"It doesn't have to be an expensive adventure — make it a short camping trip for starters during a relatively pleasant time of year," advises Michael Rutter, the Orem, Utah-based author of "Camping Made Easy."

Before you go, ask yourself some questions about what kind of camping you'll be doing — and be honest:

Fair weather, summer only? Developed campsites where your car is close at hand? Then inexpensive equipment will work fine. "There's no sense in buying something expensive or high-tech if you're not going to use it," said Will McComb, a Seattle sales representative for Kelty outdoor gear.

Any weather, any time from spring to fall? Backpacking as well as car camping? Then you'll want to invest in gear that will last more than a few outings.

You can rent gear for starters or buy everything at once — REI sells a basic family camping package for $433 (four-person tent, two sleeping bags and camp stove).

Better yet, borrow gear from your fleece-wearing, Teva-shod, ultralight-backpacking neighbors. Then slowly start your own camping collection.

"But don't skimp too much on your investment by just looking for the best bargain. ... It's a long-term investment. You'll be using this gear for decades," said Rick Granstrom, an REI camping sales associate who is still camping with some gear he bought 30 years ago.

Gear: five must-haves

Tent: Price range — $40 to $450 for a four-man tent.

Key differences: weight and quality of the materials and construction. Shock-corded poles mean you can set up most tents in five minutes or less.

Tips: Choose a tent for the toughest conditions you're likely to encounter. A basic three-season tent works well for the majority of car campers. Take the tent-capacity rating with a grain of salt — a four-man tent may not be big enough for two adults, two kids and their gear. Some tents come with sealed seams; others require you to do it yourself using a bottle of seam-sealer. Test-drive your tent by setting it up in your front yard before you go camping.

Look for: aluminum poles (lighter and more durable than fiberglass); a large rain fly that covers the whole tent (not just the top); good ventilation; double-stitched seams and a wide-tooth zipper; pockets or a storage "attic" that suspends your gear from the roof. You also may want a tarp matching the same "footprint" of the tent to protect the tent bottom from tears and moisture.

Sleeping bag: Price range — $18 to $300.

Key differences: Temperature rating, material and quality of construction. Temperature ratings indicate the coldest temperatures the bag is designed to handle while keeping the average camper comfortable. Synthetic is cheaper and provides decent insulation when wet. Down is spendier, lighter-weight and compresses to a smaller size but provides little insulation when wet. Down also lasts longer if cared for properly.

Tips: Choose a bag for the coldest nights you expect to face. Mummy-shaped bags keep you warmer but can be constricting; rectangular ones give you more space for tossing and turning but are bulkier and don't keep you as warm. Sleeping bags usually can be zipped together to create a larger sleeping space for two. You can add an inexpensive fleece liner in a sleeping bag and drop the temperature rating 10 to 15 degrees.

Sleeping pad: Price range — $6 to $200.

Key differences: material, style, thickness. Self-inflating pads are the most expensive, comfortable and compact. Unroll it, open the valve, and it's ready to use. Open-cell foam pads are comfy and cheap, but bulky and spongelike in wet conditions. Closed-cell foam pads are cheap and durable, but thinner and not as comfortable. Air mattresses are relatively inexpensive (and can double as water toys for the kids!), but they're bulky and prone to punctures.

Tips: Some pads can be attached to create a larger sleeping surface. Some can be converted into camp chairs.

Stove: Price range — $13 to $150.

Key differences: single or double (even triple) burners; size and weight; fuel (propane or white gas); BTU rating — the higher it is, the more heat it puts out. Most are suitcase-shaped, tabletop stoves. Some have legs and grill/burner combos.

Tips: Propane is easier to get, and less stove maintenance is required. You can use a disposable bottle or refillable tank. White gas (or Coleman fuel) burns cleaner, hotter and longer but requires pumping and priming the stove to get it started.

Look for: a wind screen. And a fuel line that's attached to a propane stove means you're less likely to lose it.

Cooler: Price range — $13 to $100.

Key differences: plastic or steel; hard- or soft-sided.

Tips: A basic plastic cooler will do. Get a wheeled one for convenience. A hard-sided one can double as a shelf or chair. Instead of buying ice, consider freezing water in Ziplocs, giving you a convenient source of clean water for drinking or cooking as it melts.

Eating al fresco

Food: Keep it simple.

One-pot meals save time on cleanup. Or do the food-prep work — cutting veggies, marinating meat, making sandwiches — at home.

Easier yet: Cook hot dogs on a sharpened stick over the fire.

Gear: You can buy all kinds of special cookware and kitchen gadgets for camping, but there's really no need for special supplies — just bring pots, plates and spices from home.

If you forget something — and it's almost guaranteed — it's likely to be a basic piece of kitchen or cooking equipment: matches, a sharp knife, condiments, a spatula, oven mitts, butter, soap. But part of the fun of camping is improvising, and some of the best camping memories come from surviving things that go wrong.

Secrets of successful camping

Picking your location: Look for tent-only sites — there's nothing worse than trying to tent-camp next to a noisy RV. Pick a site that's not too close to the restroom to cut down on traffic and avoid being bothered by the lights at night.

Common rookie mistakes: Planning a trip that's too long (a weekend is about right). Not being prepared for rain or bugs (bring a poncho; spray bug repellent around the doorway of your tent). Taking too much stuff (keep notes on what you used, what you didn't and what you forgot for next time). Forgetting toilet paper and paper towels.

Set out flashlights or lanterns and sleeping bags early. You'll be glad you did at dusk.

Ultimate secret weapons: Extra socks kept dry in a Ziploc. Baby wipes for dish cleanup or a "cowboy bath" at the end of the day.

Where to get a deal

Renting gear: Many local outdoor stores rent camping gear. Or try www.lowergear.com, a Scottsdale, Ariz.-based company that offers camping and backpacking equipment rentals delivered to your home or even your camping destination.

New and used gear: Federal Army and Navy Surplus, 2112 First Ave., Seattle. 206-443-1818; www.gr8gear.com

Garage sales: often have secondhand camping gear.

Reservations and resources

Federal lands: www.reserveusa.com handles reservations for campsites within the Forest Service, Army Corps of Engineers, National Park Service, Bureau of Land Management and Bureau of Reclamation. Or call: 1-877-444-6777.

National parks: Mount Rainier or Olympic National Park reservations, go to reservations.nps.gov or call 1-800-365-CAMP (2267).

Washington state parks: www.camis.com/wa/ or 1-888-226-7688.

Online know-how: For camp songs, camp recipes, camping checklists and more, try these Web sites: www.familycampinggear.com www.michcampgrounds.com www.campfirechronicle.com

REI's Web site: www.rei.com, includes detailed articles on how to choose a tent, a sleeping bag and other basic gear.

Jolayne Houtz: jhoutz@seattletimes.com or 206-464-3122

Copyright © 2004 The Seattle Times Company

 
 
 
Google
Web www.iconocast.com
 
 
 

 

Continue News With: News4 ; News5 ; News6 ; News7 ; News8 ; News9 ; Nedws9A


ADVERTISEMENT

Iconocast is about learning and teaching without borders; we offer eMarketing, Internet Advertising, Internet Marketing, Search Engine Optimization, Search Engine Marketing, Online Branding, and eMarketing News Services. Home

 © 2002-2006

Keywords::

Contact Iconocast

Home Page