Iconocast Logo

Welcome To Iconocast

How to add a URL link from your web site to the Iconocast web sites

Virtual tour of Southern California


Recent News and Articles on the Keywords: multiple + relapsing + fingolimod  Related to the article below (Last Update: 12/1/2008)

 News results: Standard Version | Text Version | Image Version Results 1 - 3 of about 8 for multiple relapsing fingolimod. (0.09 seconds) 
Recent
Archives
  • All dates
  • 2008
  • 2007
  • 2006

 Sorted by relevance   Sort by date   Sort by date with duplicates included 

Sovo.com
Emory researchers test MS drug as HIV suppressant
Sovo.com, GA - Nov 7, 2008
... to continue testing Fingolimod, code-named FTY720. The drug is currently undergoing clinical trials to prevent relapses of multiple sclerosis. ...
Novartis highlights innovative approach to drug discovery with ...
PR-USA.net (press release), Bulgaria - Nov 20, 2008
FTY720 (fingolimod) has the potential to be the first sphingosine-1-phosphate receptor (S-1-P) modulator, a new class of therapeutics that act on ...NVS - BOM:500672
Novartis "hold"
AktienCheck, Germany - Nov 27, 2008
Das p?diatrische Zulassungskomitee PDCO habe gegen?ber Fingolimod (FTY720) in einer neurologischen Anwendung bei Kindern positiv Stellung bezogen. ...
Source: Google News


 

Recent News and Articles on the Keywords: relapsing multiple + multiple + 390  Related to the article below (Last Update: 8/7/2008)

Modigene wins Israeli grant for multiple sclerosis research program
Pharmaceutical Business Review -
Interferon beta is a drug used to reduce the frequency and severity of relapses afflicting people suffering from multiple sclerosis, an autoimmune ...
How it feels: Multiple sclerosis
Chicago Tribune, United States - Aug 3, 2008
He didn't believe she had enough symptoms to make a diagnosis, yet he felt unable to rule out a frightening possibility: multiple sclerosis, ...
BioMS Medical's relapsing-remitting multiple sclerosis trial ...
FOXBusiness - Jul 17, 2008
(TSX: MS), a leading developer in the treatment of multiple sclerosis (MS), today announced that the independent Data Safety Monitoring Board (DSMB) for the ...
BioMS Medical completes patient recruitment in phase III US ...
Canada NewsWire (press release), Canada - Aug 1, 2008
(TSX: MS), a leading developer in the treatment of multiple sclerosis (MS), today announced that it has completed patient recruitment in its phase III ...TSE:MS
ZymoGenetics Inc. Q2 2008 Earnings Call Transcript
Seeking Alpha, NY - Aug 5, 2008
Atacicept is also being tested in large, well-controlled Phase II clinical trials in rheumatoid arthritis and relapsing multiple sclerosis. ...ZGEN
Peptimmune Announces Grant of United States Patent for PI-2301 ...
MarketWatch - Jul 30, 2008
PI-2301 is currently in a Phase Ib multiple-ascending dose, double-blind, placebo-controlled randomized study in subjects with multiple sclerosis. ...
Modigene wins grant for Washington Univ. MS research
Bizjournals.com, NC - Aug 5, 2008
... a drug used to reduce the frequency and severity of relapses afflicting people suffering from multiple sclerosis, an autoimmune neurological disorder ...OTC:MODG
Pharmacologic Management of Multiple Sclerosis
RedOrbit, TX - Jul 23, 2008
Multiple sclerosis (MS) is a chronic disease of the central nervous system (CNS), which is composed of the brain, optic nerves, and spinal cord (Graham, ...
BioMS Medical's Relapsing-Remitting Multiple Sclerosis Trial ...
RTT News, NY - Jul 17, 2008
TO: News, Chart, Quote ) said its Phase II MINDSET-01 trial of MBP8298 in patients with relapsing-remitting multiple sclerosis completed a safety analysis ...
Alexion Secures US Patent for ALXN6000, a First-In-Class Anti ...
PR Newswire (press release), NY - 10 minutes ago
... of tumors involved in several types of cancers, including CLL, multiple myeloma, non-Hodgkins lymphoma, melanoma, ovarian cancer and neuroblastoma. ...ALXN
Source: Google News

Gadolinium enhanced MRI predicts clinical and MRI disease activity in relapsing-remitting multiple -
T Koudriavtseva, AJ Thompson, M Fiorelli, C … - British Medical Journal, 1997 - jnnp.bmj.com
... 11(4): 390 - 394. [Abstract] [PDF], Home page, Radiology Home page J. He, M. Inglese,
BSY Li, JS Babb, RI Grossman, and O. Gonen Relapsing-Remitting Multiple ...

Axonal pathology in multiple sclerosis: relationship to neurologic disability. -
BD Trapp, R Ransohoff, R Rudick - Current Opinion in Neurology, 1999 - co-neurology.com
... on cerebral atrophy in relapsing multiple sclerosis [abstract ... Multiple sclerosis:
oligodendrocyte proliferation and differentiation in ... Nature 1983; 303:390-396. ...

Using gadolinium-enhanced magnetic resonance imaging lesions to monitor disease activity in multiple -
HF McFarland, JA Frank, PS Albert, ME Smith, R … - Annals of Neurology, 1992 - doi.wiley.com
... experimental therapies in multiple sclerosis (MS) difficult. ... can be demonstrated
by magnetic resonance imaging (MRI) in patients with mild relapsing-remitting ...

… mRNA are associated with disease activity and characterize different disease stages in multiple -
AH van Boxel-Dezaire, SC Hoff, BW van Oosten - multiple sclerosis, 1999 - doi.wiley.com
... 602 bp 390 bp IL-12p35 antisense CCTAGTTCTTAATCCACATC ... Fig 1. Longitudinal cytokine
profile of a relapsing?remitting multiple sclerosis (MS) patient. ...

… Study of Callosal Atrophy and Interhemispheric Dysfunction in Relapsing-Remitting Multiple -
J Pelletier, L Suchet, T Witjas, M Habib, CRG … - Archives of Neurology, 2001 - Am Med Assoc
... A Longitudinal Study of Callosal Atrophy and Interhemispheric Dysfunction
in Relapsing-Remitting Multiple Sclerosis J. Pelletier ...

The role of magnetic resonance techniques in understanding and managing multiple sclerosis -
DH Miller, RI Grossman, SC Reingold, HF McFarland - Brain, 1998 - Oxford Univ Press
... lesion load has correlated strongly with change in EDSS over a 3-year period in
secondary progressive but not relapsing? remitting multiple sclerosis (Truyen ...

Absence of HHV-6 and HHV-7 in cerebrospinal fluid in relapsing-remitting multiple sclerosis. -
C Taus, E Pucci, E Cartechini, A Fie, G Giuliani, … - Acta Neurologica Scandinavica, 2000 - pt.wkhealth.com
... sclerosis. Multiple Sclerosis 1997;3:390-4. [Context Link]. 23. ... Keywords: herpesvirus;
HHV-6; HHV-7; relapsing-remitting multiple sclerosis. ? 2000 ...

Acute axonal injury in multiple sclerosis: Correlation with demyelination and inflammation -
A Bitsch, J Schuchardt, S Bunkowski, T Kuhlmann, W … - Brain, 2000 - Oxford Univ Press
... and TNF -2 (TCGGCAAAGTCGAGATAGTCG) amplified a 390 bp fragment on ... in secondary
progressive than in relapsing?remitting multiple sclerosis (Matthews ...

Assessing the risk of early multiple sclerosis in patients with clinically isolated syndromes: the … -
PA Brex, KA Miszkiel, JI O'Riordan, GT Plant, IF … - British Medical Journal, 2001 - jnnp.bmj.com
... (J Neurol Neurosurg Psychiatry 2001;70:390-393) Keywords ... 1 year, a large prospective
study of patients with relapsing-remitting multiple sclerosis has ...

A new approach to affective symptoms in relapsing-remitting multiple sclerosis -
S Noy, A Achiron, U Gabbay, Y Barak, Z Rotstein, N … - Comprehensive Psychiatry, 1995 - Elsevier
... main clinical subcategories, chronic progressive and relapsing-remitting (RR ... 5
(September/October), 1995: pp 390-395 ... AFFECTIVE SYMPTOMS IN MULTIPLE SCLEROSIS ...

Source: Google Scholar
 
 

Fingolimod: sustained efficacy over 18 months in patients with relapsing multiple sclerosis

Data from the extension of a Phase II study to 18 months support the significant effects of FTY720 ( Fingolimod ), a novel once-daily oral compound in development for treatment of relapsing-remitting multiple sclerosis.

The data, presented at the American Association of Neurology ( AAN ) Meeting, showed that both patient groups taking FTY720 ( 1.25 mg and 5 mg ) who had experienced more than a 50% reduction in their annualized relapse rate during the study's first six months compared to placebo maintained this low relapse rate during the subsequent 12-month extension.

Currently marketed multiple sclerosis therapies afford an average reduction in relapse rates of only 30% in two-year studies and require frequent injections ranging from daily to weekly.

. In patients who switched from placebo to either the 1.25 mg or 5 mg dosing of FTY720 after six months, the annualized relapse rate was reduced to a similar extent during the subsequent twelve-month extension phase of the study compared to the first six months on placebo.

At month 18, Magnetic Resonance Imaging ( MRI ) scans were performed in a subgroup of patients.
Consistent with what was seen in MRI scans at month six, the vast majority of patients were free from lesions showing active inflammation at month 18.

The most frequently reported adverse events in patients treated up to 18 months were non-serious infections ( colds, influenza ) and headache.
Effects initially seen in the first six months of treatment ( i.e. first dose heart rate reduction, increase in blood pressure, alteration in liver function, mild increase in airway resistance ) did not appear to progress with continued dosing beyond six months.
There were also no unexpected safety findings during the extension phase compared to the six-month placebo-controlled phase.

All patients in the extension study are now continuing with the 1.25 mg dose since both the 5 mg dose, which had a higher rate of adverse events, and 1.25 mg doses were equally effective in reducing disease activity.

Fingolimod binds to the sphingosine 1-phosphate receptor-1 ( S1P1 ) on a proportion of circulating lymphocytes and reversibly traps them in the lymph nodes.
As a result, Finfolimod lowers the number of activated T-cells circulating to the blood stream and central nervous system ( CNS ), which reduces neuroinflammation and myelin damage in the brain and spinal cord.
Under Fingolimod treatment, many components of normal lymphocyte function are unaffected and can be activated as part of the immune response within the lymph nodes and other tissues.

Source: Novartis, 2006

 
 
 
Google
Web www.iconocast.com
 
 

 

Continue News With: News6 ; News7 ; News8 ; News9 ; News9A


ADVERTISEMENT

Iconocast is about learning and teaching without borders; we offer eMarketing, Internet Advertising, Internet Marketing, Search Engine Optimization, Search Engine Marketing, Online Branding, and eMarketing News Services. Home

 © 2002-2006

Keywords:

Contact Iconocast

Home Page