Iconocast Logo

Welcome To Iconocast

How to add a URL link from your web site to the Iconocast web sites

Virtual tour of Southern California



 

Recent News and Articles on the Keywords: lsu + genome + 0.29  Related to the article below (Last Update: 8/5/2008)


The Money Times
Get ready for some LSU football
Houma Courier, Louisiana -
OK, now it?s time to get serious about taking stock of the LSU football team. Not that people hadn?t before, but there?s no sense of urgency in April and ...
What's hot (and not) for 2008 ESPN
USC Trojans Have Easiest Path to 12-0 Bleacher Report
Plenty of interesting games set for college football this season Jackson Sun
Columbus Ledger-Enquirer - ESPN
all 334 news articles »
Passing fancy?: Quarterbacks are even in LSU camp
Monroe News Star, LA -
By Glenn Guilbeau ? Gannett News Service ? August 5, 2008 BATON ROUGE ? The first true, three-pronged quarterback derby at LSU in a decade started Monday as ...
LSU QB's start on good note The Times-Picayune - NOLA.com
A dead heat for LSU spot 2TheAdvocate
LSU players report for new season Shreveport Times
StarNewsOnline.com - The Times-Picayune - NOLA.com
all 28 news articles »
LSU, new chancellor get acquainted
The Times-Picayune - NOLA.com, LA -
"We are colleagues in this together," Martin told the new students gathered Monday at the LSU Union in the heart of the campus. ...
Dr. Michael Martin starts working as LSU's chancellor WBXH
New LSU chancellor begins tenure with meetings KATC
New LSU chancellor begins WXVT
2TheAdvocate
all 16 news articles »
Recruiting: Rayville?s Kenny Bell decides on LSU
Monroe News Star, LA -
Bell made a decision Monday about his future and that choice was LSU. The nation?s top 20 receiver made the call to LSU coach Les Miles at approximately 3 ...
Rayville's Bell commits to LSU Bastrop Daily Enterprise
Rayville receiver Kenny Bell commits to LSU The Times-Picayune - NOLA.com
LSU adds commitment Shreveport Times
And the Valley Shook - Monroe News Star
all 9 news articles »
LSU position-by-position
Opelousas Daily World, LA -
BATON ROUGE or LSU football fans, the two words carry the same significance as those four - "Pitchers and catchers report" - that signal the dawn of spring ...

WWL
Louisiana Sports: New Orleans Saints, Drew Brees, Arizona, LSU ...
Bayou Buzz, LA -
Former LSU standout Skyler Green showed bursts of speed when he returned a kickoff 95 yards up the middle for a touchdown and when he hauled in a 47-yard ...
Skyler Green's Diary Part 4 WWL
all 2 news articles »
Web site, LSU SGA team to fight textbook costs
2TheAdvocate, LA -
By GEORGE MORRIS When two LSU students created a Web site in 2005 to help fellow students buy and sell used textbooks, they learned a hard fact of business ...

USA Today
Nebraska?s improvement rides on give and take
Kansas City Star, MO -
At LSU, where he served for three years, the Tigers improved from near the bottom of turnover margin in Pelini?s first year to second nationally behind ...
A state turns to Pelini Dallas Morning News
Under new coach Pelini, Nebraska gets back to basics USA Today
Pelini maintains balance in new Nebraska job NCAAfootball.net
Lincoln Journal Star - Grand Island Independent
all 12 news articles »
LSU Looks To Defend National Title With New QB
AHN -
LSU will rebuild the back of the defense around preseason All-SEC linebacker Darry Beckwith. The offense lost two key players in leading rusher Jacob Hester ...

The Times-Picayune - NOLA.com
Violence in Kenya gave LSU runners an unsettling season
The Times-Picayune - NOLA.com, LA -
He started his college career at Virginia Intermont College, an NAIA school with an enrollment of 772, and he transferred to LSU last year when Virginia ...
Source: Google News

Temporal changes on genetic diversity in a sugarcane breeding population using TRAP markers
S Edme, ALSU Suman, CLSU Kimbeng - Plant Genome Conference Proceedings, 2006 - ars.usda.gov
... Kimbeng, Collins - LSU. ... Plant Genome Conference Proceedings. ... are genetic differences
among the populations with evidence of inbreeding (FIS=0.49?0.29, 'B = FST ...
-

… in yeast: gene order and structural organization of the mitochondrial genome of Saccharomyces uvarum -
B Cardazzo, S Minuzzo, G Sartori, A Grapputo, G … - Current Genetics, 1998 - Springer
... COX II pYJL28 Sd rho ? r161/1 0.29 Tian et al ... three associ- ations of genes present
in the K. thermotolerans mitochon- drial genome (SSU-rRNA/LSU-rRNA, ATP6 ...

[PDF] Predicting Progeny Performance and Genome Analysis in Sugarcane (Saccharum spp)
S Alwala - 2007 - etd.lsu.edu
... PROGENY PERFORMANCE AND GENOME ANALYSIS IN SUGARCANE (SACCHARUM SPP) A Dissertation
Submitted to the Graduate Faculty of the Louisiana State University and ...

Ocular reactivation phenotype of HSV-1 strain F (MP) E, a corticosteroid-sensitive strain -
ME Marquart, PS Bhattacharjee, X Zheng, HE Kaufman … - Current Eye Research, 2003 - ingentaconnect.com
... from McKrae after corticosteroid injection (P > 0.29). ... Genome copies for both strains
were present ... Microbiology, Immunology & Parasitology, LSU Health Sciences ...

Body temperature, rate of biosynthesis, and evolution of genome size -
X Xia - Molecular Biology and Evolution, 1995 - SMBE
... Key words: genome size, biosynthesis, body temperature, organic evolution, optimality
model. ... E-mail: xuhua@unix 1 .sncc.lsu.edu. Mol. Biol. Evol. ...

Linkage mapping and genome analysis in a Saccharum interspecific cross using AFLP, SRAP and TRAP …
S Alwala, CA Kimbeng, JC Veremis, KA Gravois - Springer
... made at the Sugarcane Research Unit, USDA-ARS, Houma, Louisiana. ... spanning 45 LGs
with a cumulative genome length of ... 8 0?1 0?3 Average 4.76 3.47 0.29 1.00 a ...
-

[PDF] Seasonal Abundance and Detection of West Nile Virus in Ceratopogonids (Diptera: Ceratopogonidae) in …
IJ Sabio - 2005 - etd.lsu.edu
... on dry ice to the Diagnostic Laboratory at the Veterinary School at LSU, and ... 1180
genome position) and primer sequence reverse 5?GGGTCAGCACGTTTGTCATTG3? ...

[PDF] Characterizing Salmonella Fecal Shedding among Racehorses in Louisiana
AM Chapman - 2006 - etd.lsu.edu
... samples from domestic species and wildlife. In Louisiana, the most common serotypes
isolated from people ... small deletions in the genome. [18 ...

[PDF] Agronomic and Molecular Characterization of Louisiana Native Spartina Alterniflora Accessions
AB Ryan - 2003 - etd.lsu.edu
... km. estimated during the colonial times (LSU Agricultural Center, 1995). ... restoration?,
undertaken by LSU Agricultural Center and USDA-NRCS, is to ...

[PDF] DEVELOPMENT OF A MULTIPLEXING STRATEGY FOR WHOLE GENOME SCANS OF THE DOMESTIC DOG AND ANALYSIS OF … -
EJ CARGILL - 2004 - txspace.tamu.edu
... was characterized, prior to this work, for whole genome scans of the domestic ... George
Strain, of Louisiana State University, for providing the first contact to ...

Source: Google Scholar
 

LSU professor involved in genome sequencing of the first marsupial

Genome sequence of the gray, short-tailed opossum, Monodelphis domestica, is revealed

BATON ROUGE – Since the launch of the Human Genome Project, which released a first draft of the entire sequence of human DNA in 2001, many researchers have dedicated themselves to creating a library of comprehensive, species-specific genetic sequence "maps" available for study. Scientists at LSU recently took part in a multi-institutional effort spearheaded by the Broad Institute of MIT and Harvard University to sequence the complete genome of the gray, short-tailed opossum, Monodelphis domestica.

As the first marsupial, a mammal equipped with a special "pouch," to be sequenced, the opossum provides a unique perspective on the organization and evolution of mammalian genomes. The results will be published in the journal Nature on Thursday, May 10.

Article continues below and (thank you)

 

Marsupials diverged from a common ancestor with placental mammals, a group including humans, approximately 180 million years ago. Marsupials and placental mammals are more closely related to one another than to any other vertebrate model species, such as birds, amphibians or fish, yet marsupials are also genetically distinct from all current mammalian biomedical research models. This makes the marsupial an integral part of evolutionary and biomedical studies.

Kangaroos of Australia and the North American opossum, which is abundant in Louisiana, typically come to mind when one thinks of marsupials. However, Monodelphis domestica, a South American opossum, was chosen for genome sequencing because it is the predominant laboratory-bred research marsupial in the world and therefore represents an important model organism for comparative genomics. Studies in this species will help to identify genome features common to all mammals and will also help to pinpoint specific differences between placental and non-placental mammals.

"Mapping the opossum genome is a significant achievement for many reasons," said Mark Batzer, Andrew C. Pereboom Alumni Departmental Professor of Biological Sciences at LSU, and one of the project investigators. "It provides unprecedented insight into connections between humans and other species and will help elucidate the underlying genetic mechanisms that are common in mammals versus the evolution of distinctly human differences in gene regulation, expression and function."

The evolution of mobile elements, or "jumping genes," in mammalian genomes is a primary focus of Batzer's research at LSU. Mobile elements were generally thought to have no function, yet these elements have been shown to cause diseases in humans and also be involved in the creation of new gene families. As a consequence, understanding the impact of mobile elements on genome structure is paramount to understanding the function of the gene.

Batzer and his colleagues, Andrew Gentles, a researcher at Stanford University, David Pollock of the University of Colorado Health Sciences Center and Jerzy Jurka from the Genetic Information Research Institute, investigated the overall mobile element composition and evolution of mobile elements within the opossum genome in the main Nature paper and report additional detailed findings in a companion paper to be published in Genome Research, also on May 10. They found that mobile elements make up about 52 percent of the opossum genome, compared to only about 50 percent in primate genomes, and have distinct compositional differences as well.

In addition, they report that transposable elements appear to have been involved in a specific biological function, perhaps regulating gene expression. Thus, the mobile elements that are typically thought of as "junk DNA" have played a creative role in genome evolution – spreading key genetic innovations involved in the control of gene expression across the genome.

Mobile elements are also commonly utilized for studies of population and species-specific genetic diversity. The genetic diversity and ancestral population structure of recently active mobile elements in diverse opossum populations is the topic of a second companion paper to be published shortly in the journal Gene. These detailed analyses were performed in collaboration with Pollock, Gentles, Jurka and David Ray of West Virginia University.

###

For more information on the sequence and analysis of the opossum genome or mobile elements, please contact Mark Batzer at 225-578-7102 or mbatzer@lsu.edu.

*Media Note: Batzer will be out of town until Friday, May 11. He asks that media interested in speaking with him send an e-mail and he will contact them immediately.

More news and information can be found on LSU's home page at www.lsu.edu

 
 
 
Google
Web www.iconocast.com
 
 
Continue News With: News9 ; News9A


ADVERTISEMENT

Iconocast is about learning and teaching without borders; we offer eMarketing, Internet Advertising, Internet Marketing, Search Engine Optimization, Search Engine Marketing, Online Branding, and eMarketing News Services.

 

Iconocast Home Page

 © 2002-2006

Keywords:

Contact Iconocast